Oligonucleotide sequences for TruSeq Small RNA Sample Prep KitsĮxample (all Illumina sequences unless noted):ĥ’ AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGAĪATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGTCCGA - this is the NEB SR Primer R1 - pads added by SPHSĥ' RNA adaptor GUUCAGAGUUCUACAGUCCGACGAUC (NEB kit calls this the SR Adaptor 1) So order RC of TruSeq Adaptor Indexes as PCR primers TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG Mux read 2 seq primer (reversed)ĬTTGAGGTCAGTGGAACATTAGAGCATACGGCAGAAGACGAAC Index 12 PCR primer (reversed) Oligonucleotide sequences for TruSeqTM RNA and DNA Sample Prep Kits1ĥ’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCGATGTATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGACCAATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGĥ’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACCTTGTAATCTCGTATGCCGTCTTCTGCTTGĥ' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC Mux index read seq primer Some additional 5 bp barcodes can be found here: Īfter exhaustive searching of all 4096 6-mers, the following table is all remaining 6 bp barcodes that have hamming distance of at least 3 from each other and the table above of 49 barcodes (NOTE: these have NOT been tested on the sequencer as of 2/7/12): NOTE that TSBC41 is hamming distance 2 away from both TSBC31 and TSBC11 all others are hamming distance >=3. In other words, here is the first barcode shown in the context of the full 3'-end adaptor construct: GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG Note that these sequences are shown 5'-3' when the P5 sequence is on the left. The GSAF uses the following names for the following barcodes. If you are using dual-indexed samples with an additional barcode between the P5 bridge PCR primer site and the Read 1 sequencing primer site, we can easily accommodate that on a run but do not normally do so - you need to tell us. The GSAF expects indexes to be in the 3' end of the final sequencing construct, between the Index read sequencing primer site and the P7 PCR primer site. NOTE: Illumina barcodes (indexes) have varied significantly over time NOT ONLY in their sequence but also in WHERE they are placed in the sequencing construct. I7 bases for entry on sample sheet (HiSeq, MiSeq, or NextSeq)
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |